Full Text: 1 Introduction Mesua ferrea L., Family – Calophyllaceae, is a very important medicinal plant. It is a medium-sized evergreen plant distributed in almost all Asian countries like Burma, Cambodia, Indonesia, Malaysia, Srilanka, Myanmar, Nepal, Philippines, Sumatra and Thailand (Asif et al., 2017). M. ferrea is widely used as an antipyretic, antimicrobial, anticancer, carminative, cardiotonic, diuretic and expectorant (Rahman et al., 2008; Chahar et al., 2012). In India also, M. ferrea is widely used in the number of ayurvedic medicines for the treatment of many diseases like bleeding piles, cough, cardiovascular disorder, dysentery, excessive thirst, scabies (Joseph et al., 2010; Lim, 2012). Presence of phytochemicals like xanthones, terpenoids and sterol justify its medicinal properties (Keawsa-ard et al., 2015). M. ferrea tree is threatened by many fungal pathogens among these foliar pathogens are also well reported. Presence of the fungal genus Colletotrichum sp. was also reported from the tree (Sunkar et al., 2017).  Genus Colletotrichum was first reported by Tode (1790) as the genus Vermicularia, while its current name was established by Corda (1831) for C. lineola (Cannon et al., 2012). This genus is considered as the plant pathogenic genus which causes diseases in various economically important plants (Jayawardena et al., 2016). According to Dean et al. (2012), its host range varies from trees to the small grasses. The Colletotrichum sp. exhibits various natures such as endophytic, parasitic, saprophytic lifestyles (Kumar, 2014). The inoculums of Colletotrichum are disseminated through wind or rain from one to another host and for the extensive growth and higher degree of infection; it requires warm and humid conditions (Purkayastha & Sen Gupta, 1973; Farr et al., 2006; Kumar, 2014). During the intensive survey of Dr Harisingh Gour University, Sagar botanical garden vegetation, conspicuous pinhead dots was reported on the leaves of M. ferrea. Aim of this investigation was to identify fungal pathogens associated with these pinheads dots.   2 Materials and Methods 2.1 Sample collection: The weather of Sagar M.P. is highly humid and rainy from July to November which favours the growth and development of various fungal pathogens (Figure 1).  The infected leaves of M. ferrea plants were collected in new unused polythene bags from the botanical garden of Dr Harisingh Gour University, Sagar. Each polythene bag was marked by paper tag on which descriptions of the host plant, local name, place, collection date, symptoms and serial number were noted (Mall & Kumar, 2014; Sabeena et al., 2018). After returning from the field visit, sample specimens were kept between blotters for proper pressing, this absorbs moisture which helps in avoiding saprophytic cross contaminators (Sabeena et al., 2018). 2.2 Isolation of fungi & Morphological characterization        The collected samples were processed according to the standardized procedure (Savile, 1962; Hawskworth 1974). The detailed and critical morphological identification was carried out with the help of Scanning Electron Microscope (NOVA NANOSEM 450). For this, specimens were dehydrated and coated with conducting material (Gold) to prevent charge built from electron beam (Hall & Hawes, 1991). The SEM microphotograph revealed the unseen structures of the fungus and their measurements. With the help of standard monographs of Coelomycetes (Sutton, 1980) and some other important available literature, the comparison list was prepared (Table 2). The Holotype of the specimen has been deposited for accession number in Ajrekar Mycological Herbarium (AMH) of Agharkar Research Institute (ARI), Pune, Maharastra India. 2.3 Molecular characterization For molecular studies, the fungal organism was isolated from the infected leaf of M. ferrea and aseptically transferred to the PDA media. The pathogen grows prolifically on PDA media under a controlled environment at 25-28^oC in the incubator. Vigorous growth was obtained after the fifth day of inoculation, by subsequent subculture process, pure culture of the desired isolate obtains. The pure culture has also been deposited to the National fungal culture collection of India (NFCCI), Agharkar Research Institute (A.R.I.) Pune, Maharastra (India) for the accession. DNA from the pure culture was isolated by using the CTAB extraction buffer (Carlier et al., 1996). This isolated DNA was used for the sequencing and distinguishes differences between various Colletotrichum species by Mills et al. (1992) method. The variation in the sequence of the ITS1 region of rDNA used for the detection of polymorphisms in the same region between various strains of Colletotrichum (Sreenivasaprasad et al., 1992). ITS4 & ITS5 universal primers (White et al., 1990) were used to amplify the ITS gene in sequencing PCR ABI3100 automated DNA sequencer with ABI-BigDye® Terminator 3.1 Cycle sequencing kit. The sequence of the Universal ITS primers used in the current study are: ITS 4 (5′TCCTCCGCTTATTGATATGC3′) (Forward primer) ITS 5 (5′GGAAGTAAAAGTCGTAACAAGG3′) (Reverse primer)  To render the similarities between different species the DNA sequence BLAST (Basic Local Alignment Search Tool) is done on the NCBI website (https://blast.ncbi.nlm.nih.gov). The DNA sequence was also deposited in the NCBI database and obtain genebank accession no. MH352480. The DNA sequences of the other similar species were downloaded and utilized for making a phylogenetic tree by using MEGA-X. Host records were checked for the novelty of the taxa by using the Index Fungorum website (http://www.indexfungorum.org) and the USDA website (https://nt.arsgrin.gov/fungaldatabases). 2.4 Phylogenetic analysis For the conversion of the raw DNA sequence into the fasta format EMBOSS programs-EMBL-EBI online software is used, DNA Sequence (Fasta format) is used for the NCBI BLAST (Basic Local Alignment Search Tool). NCBI BLAST hits provide the sequence similarity percentage, query coverage, E-value (Table 3) in between the sequences already submitted by the different workers, with these data, it is easier to identify the isolate at the species level, it also provides the facility to download the most related sequences for making the phylogenetic tree by aligning them using Muscle (Edgar, 2004) in MAGA X (Hall,  2013) software, which gives the clear cut estimation of the relationship between the taxa (Sequences) (Nei & Kumar, 2000; Felsenstein, 2004; Hall, 2011).  Now the test of phylogeny was done by the bootstrap method using the maximum likelihood statistical method, with 1000 replications. 2.5 Pathogenicity test The conidial suspension is spread over the artificially damaged M. ferrea leaves and keeps in incubation at room temperature (25⁰C – 28⁰C) for the proper spreading of the fungal infection. After 72 hours of inoculation, fungal infections start appearing over the leaf surface same as obtained during the investigation and at the end of the seventh-day ambient infection observed. This test was applied in triplet sets in which the optimum temperature varied (Table 1) 3 Results 3.1 Morphotaxonomic Identification: Leaf spots are amphigenous, irregular, starts from the acute apex of the leaf and further extending back (Figure 2). The colony is epiphyllous with fine pinhead dots, dark brown to dark black with internal mycelium. Conidiomata are acervular, cuticular, dehiscence irregular, 37.50 – 75 x 22.5 – 50 µm. Sclerotia are indistinct. Setae are present and arise from the base of conidiomata, abundant, small to long, straight to flexuous, base swollen, tapering apex, dark brown to black, aseptate, 25 – 175 x 2.5 – 7.5 µm. Conidiophores are mostly indistinct, 8.7 – 16.43 µm in size in SEM imaging (Figure 4). Condiogenous cells are enteroblastic, phialidic, and the average size is 1.411 µm in SEM images, hyaline, determinate. Conidia are hyaline, single-celled (aseptate), smooth, and straight to falcate acute at both ends with 12.5 – 25 x 2.5 – 5.0 µm size (Figure 3). The comparison with the allied taxa is shown in table 2. Based on the above-said characteristics, morpho-taxonomic identification suggested that isolated fungal species is Colletotrichum fusiforme Jayawardena, Bhat, N. Tangthir, K.D.Hyde,   Holotype, AMH – 9939. 3.2 Culture characteristics On PDA colony becomes 30 – 45 mm in size in 10 days at 25⁰ C. Colony is dark black in the centre while dark olivaceous green colony with the wavy edges. Reverse view of the colony is olivaceous green to black, concentric (Figure 5). On the behalf of colony characteristics and morphological characteristics isolated C. fusiforme compared with the allied taxa and this comparison is given in table 2. 3.3 Molecular Identification: NCBI BLAST analysis of top five BLAST hits indicates that the isolated DNA sequence show 100 per cent query coverage and identity with the Colletotrichum fusiforme, Fungal endophyte isolate LIES529, Colletotrichum sp. WF134, Colletotrichum sp. WF115, Colletotrichum sp. VNCF2 (Table 3). The evolutionary history was inferred by using the maximum likelihood method and the Tamura-Nei model (Tamura & Nei 1993). The bootstrap consensus tree inferred from 1000 replicates is taken to represent the evolutionary history of the analyzed taxa (Felsenstein, 1985). Branches corresponding to partitions reproduced in less than 50%   bootstrap replicates are collapsed. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) is shown next to the branches (Felsenstein, 1985). Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pair wise distances estimated using the Maximum Composite Likelihood (MCL) approach and then selecting the topology with superior log likelihood value. This analysis involved 6 nucleotide sequences. Codon positions included were 1st+2nd+3rd+Noncoding. There were a total of 1182 positions in the final dataset. Evolutionary analyses were conducted in MEGA X (Kumar et al. 2018). Culture accession and deposition number is 4272, while Genebank accession no. MH352480. Tajima's neutrality test is a population genetic evolution test (Table 4) that shows whether the genes are evolving randomly (Naturally) or non-randomly. The randomly evolving DNA sequences have mutations with no effect on the health and survival of the organism while the DNA sequences evolving by non-random process having mutations that have an impact on the health and survival of the organisms then, in this case, natural selection process occurs. When Tajima's D = 0, it indicates that observed variation in the organism is similar to the expected variation and population of the organism evolving as per mutation-drift equilibrium. No natural selection observed here. When Tajima's D<0 then negative Tajima's D signifies an excess of a low frequency of polymorphic organisms after a bottleneck or a selective sweep, indicating homozygous population size expansion. Tajima's D>0 the positive value of Tajima's D signifies a high frequency of polymorphic organisms, indicating a decrease in population size and/or balancing selection. In the current study, the value of Tajima's D is negative which indicates the increase in the homozygous population size (Figure 6). 3.4 Classification: Based on morphological, molecular and genetic characteristics, the fungal parasite isolated from the infected M. ferrea leaves was identified as Colletotrichum fusiforme and detail classification of this is as follows: Kingdom: Fungi Division: Ascomycota Class: Sordariomycetes Order: Phyllachorales Family: Phyllachoraceae Genus: Colletotrichum Species: fusiforme 4 Discussion The isolated ITS sequence show 100 per cent sequence similarity with C. fusiforme (Altschul et al., 1990) and clusters with the C. fusiforme with 77 per cent bootstrap value in the phylogram generated with Maximum Likelihood Method using MEGA-X (Tamura & Nei 1993). Tajima’s D test gives the negative value which indicates the increase in the homozygous population size. Morphologically the isolate showing great similarity with C. fusiforme in its dimensions of setae, conidia but at the same time the isolate show some differences in some of the characters such as setae (aseptate) and conidia (only smooth-walled and egutulate). The detailed phylogenetic analysis on morphological as well as a molecular basis, the isolate was identified as Colletotrichum fusiforme Jayawardena, Bhat, N. Tangthir, K.D.Hyde. The available mycological literature revealed that this is the first record from India and the first report on the host M. ferrea (Index fungorum website on June 2020). Acknowledgement The authors are grateful to the Head, Department of Botany, Dr Harisingh Gour University Sagar, M.P. for providing necessary facilities and authors are also grateful to the curator, AMH Pune, Maharashtra, India for deposition of the sample and providing accession no. Conflict of interest The authors declare that they have no conflict of interest