An International Open Access Journal
News Scroll
E-mail Alerts
Subscribe for TOC Alerts
Search Articles
sidebar
Creative Commons License

Full Text


org

Volume 6, Issue 1, February Issue - 2018, Pages:176-187


Authors: Srinivasa Babu T, Rathnamma. D, Shrikrishna Isloor, Chandranaik. BM, Veeregowda BM, Manjunath Reddy GB
Abstract: Outbreaks of ORF virus (ORFV) infection in small ruminants, which occurred in eight districts of Karnataka, India were investigated during this study. Seventy scab samples were collected from affected sheep and goats from 27 outbreaks and subjected for virus isolation and polymerase chain reaction. The ORFV was successfully isolated in the chicken embryos (CE) by CAM route of inoculation. Polymerase chain reaction (PCR) was standardized targeting B2L gene for detection of ORFV. The screening of 70 samples for B2L gene amplification revealed 60 per cent positivity of Orf infection. The phylogenetic analysis based on nucleotide and deduced amino acid sequences of full length and partial B2L gene revealed that, the ORFV isolates had highest genetic homology among them and with the other Indian ORFV isolates. The maximum genetic heterogeneity was observed with ORFV isolates from other countries. Further, full length B2L gene sequence based analysis provided significant information about the genetic relationship among the various ORFV isolates. Sequence analysis revealed high nucleotide (98.7 -100 per cent) and amino acids (98.4-99.7 per cent) identity with Indian isolates maximum with Assam/09  and  Assam/10 ORFV isolates.
[Download PDF]
Full Text: ‘ORF’ which is Old English meaning ‘rough’  also known as contagious ecthyma, sore and scabby mouth disease, contagious pustular dermatitis, infectious pustular dermatitis, affecting mainly sheep and goats causing significant economic losses in the livestock production. The disease also reported to infect wild ruminants and other mammals. The disease is distributed world wide and endemic in many countries wherever sheep and goats are raised. The disease also has a zoonotic potential affecting the people mainly farmers, veterinarians and butchers who are in direct contact with infected animals especially during shearing, docking, drenching and slaughtering or indirect contact with infected animals (Bora et al., 2011; Spyrou & Valiakos, 2015; Gelaye et al., 2016; Caravaglio & Khachemoune, 2017). The disease is highly proliferative and often self limiting. Clinically, Orf disease progresses from erythema to macule, papule, vesicle formation and then pustules to thick crusts called scabs. The scabs are often friable and mild trauma causes the lesions to bleed easily. These lesions are commonly found on muzzle, lips, around the mouth, oral mucosa, ears and around the nostrils. The lesions can also be seen on feet, eyelids and teats. Young animals are severely affected, preventing them from suckling. Severely affected animals may lose their weight and becoming more susceptible for secondary bacterial infections. Morbidity is very high in young animals and mortality is usually low. Sheep are susceptible to reinfection and chronic infection also occur  (Gelaye et al., 2016). The disease is transmitted by direct contact or through exposure to the contaminated feeding troughs and fomites. The Orf disease is caused by Orf virus (ORFV), a Parapoxvirus (PPV) genus belongs to the family Poxviridae. Orf virus is robust in dry environment and it is clear that orf outbreaks occur through direct contact with infectious materials in the environment and after this it shows systemic spread                 (McKeever et al., 1987). The Orf virus has a linear double stranded DNA of approximately 135 kb in size. The complete genome sequences of ORFV and other parapoxviruses have been published (Delhon et al., 2004). The genes that are required for viral replication are conserved in the central region of the viral genome and sequence variation is found in the terminal ends of the viral genome which encode the molecules required for virus-host cell interactions. The B2L gene of virus is a major envelope gene which encodes an envelope protein of 45kDa, a highly immunogenic protein. The B2L gene has been used for detection of ORFV by PCR and molecular epidemiological analysis of ORFV infections (Inoshima et al., 2000; Hosamani et al., 2007). An emerging feature of PPV is that it individually exhibits a highly expanding host range and can also infect humans. The present study was aimed at characterizations of Orf virus isolates based on the B2L gene sequences analysis. 2  Materials and Methods 2.1 Collection of samples A total of 70 scab samples were collected from sheep and goats from the eight districts of Karnataka which have dense sheep population (Fig.1, 2 and 3). The samples were collected in viral transport medium (VTM) and were processed as per the procedure described by OIE (2007). 2.2 Isolation of Orf virus in embryonated chicken eggs (ECE) The 11 day old embryonated chiken eggs were procured from University Poultry farm, Veterinary College, Hebbal, Bengaluru. Processed scab samples were inoculated onto chorio-allantoic membrane (CAM) of 11 day old chick embryos following the standard protocol as per OIE (2007).  Inoculated embryos and control embryos were incubated at 37°C in the presence of humidity with periodical shacking and observed daily by candling. After 5 days, the allantoic fluids and CAM were collected carefully. Chorioallantoic membranes were examined for the presence of the characteristic pock lesions. 2.3 Standardization of Polymerase chain reaction The DNA was isolated from the processed samples using QIAamp DNA Mini Kit (catalog no. 51306, Qiagen Pvt. Ltd) and final elution of DNA was done in 30 µl of elution buffer and stored at -20°C until use. Primers for PCR were synthesized. Primer 1 OVB2LF1 (5’-TCCCTGAAGCCCTATTATTTTTGTG -3’) corresponded to positions 560-583 of the B2L gene, while primer 2, OVB2LR1 (5’- GCTTGCGGGCGTTCGGACCTT C-3’) corresponded to antisense strand at positions 1138-1115 with an amplicon size of 1137bp were used in this study, these are as per the Hosamani et al.(2006). Polymerase chain reaction amplification was carried out in a final reaction volume of 25µl under the PCR conditions of initial denaturation step of 94 °C for 3 min followed by 29 cycles of 94 °C for 1 min, 52 °C for 1 min, 72 °C for 1 min and final extension of 72 °C for 7 min. The PCR products were analyzed by 1.0% agarose gel electrophoresis. The amplicons were gel purified using MinElute gel extraction kit (QIAGEN) as per manufacturer’s protocol. 2.4 Nucleotide sequencing and phylogenetic analysis The purified PCR products were sequenced at M/s Amnion Biotech Pvt Ltd, Bengaluru. Sequences were edited                    and consensus sequences assembled in Bio Edit (http://www.mbio.ncsu.eduibioedit/bioedit.html) software application. The datasets that are representative of all worldwide variants and datasets from NCBI GenBank (B2Lgene) were utilized. The sequences were analysed and determined by Clustal W method in the MegAlign program of Lasergene ((DNASTAR Inc. Madison, USA) (Thompson et al., 1994). The sequences were aligned and phylogenetic tree for B2L gene of ORFV were constructed using MEGA 6.06 software (Kumar et al., 2004). The genetic distances between sequences were calculated and used for construction of a neighbor joining tree for B2L gene (Saitou & Nei,1987).      3 Results   3.1 Collection of samples The areas of suspected field outbreaks of ORF were selected based on endemicity and geographical distribution of the disease (Figure 3). Most of the animals in unorganized farms were showing varied degrees of clinical forms of ORFV infection. Among these, few animals had lesions near eyes and ear regions and few had severe inflammation around the oral cavity. The clinical symptoms included blisters early in the infection and then crusty scabs. Sores were typically found on the lips, muzzle, mouth and also on the eye and the ears with mild pyrexia (Figure 1 and 2). The oral lesions rendered most ailing animals unable to feed, and deaths were noticed in few cases in lambs and kid. However, some animals recovered upon proper treatment. 3.2 Isolation of Orf virus in embryonated chicken eggs In the present study, Orf virus isolation was carried out from 11 day old ECE as per methods described in OIE (2007). The 100 µl of processed scab samples was inoculated by chorio-allantoic membrane (CAM) route. These inoculated eggs were incubated with regulated parameters for 5 days. After fifth day of incubation, allantoic fluids and CAM were harvested as per standard protocol (Figure 4a &b). Negative control was inoculated with sterile PBS (Figure 4c). Out of eight samples, six produced characteristic white, firm and necrotic pock lesions on the CAM (Figure 4d). Confirmation of these pock lesions was done by subjecting to PCR with B2L gene amplification of DNA extracted from the pock lesions on the CAM using commercial Qiagen tissue extraction kit. Later on, this amplified product was subjected to agarose gel electrophoresis and clear amplicon of 1137bp was visualized (Figure 5). 3.3 Screening of scab samples for B2L gene of ORFV by Polymerase chain reaction A number of experiments were performed to optimize the conventional PCR protocol, including concentration of reagents, the template DNA and thermal cycling conditions. The optimized PCR assay was established using a total volume of 25 µl. After standardization of different components of PCR, DNA extracted from 70 scab samples were subjected to PCR for detection of B2L gene of ORFV. The amplified products were subjected to agarose gel electrophoresis and clear amplicon of 1137bp was visualized (Figure 5).  In the present study, out of 70 samples from 27 outbreaks, 42 samples (60%) were positive for amplification of B2L gene of ORFV. In Tumkur district, 12 out of 21 samples were positive (57.1%) by PCR while in Chitradurga district, 17 out of 33 samples, were positive (52 %) by PCR.  3.4 Nucleotide sequence analysis A total of 70 samples were subjected for PCR by targeting B2L gene of ORFV, out of which, 42 samples were found positive for ORFV. The 16 samples, representing different regions of the Karnataka state were subjected for full length B2L gene nucleotide sequencing at M/s Amnion Biotech Pvt Ltd. Bengaluru, Karnataka. However, out of 16 samples, full length sequencing of 1137bp nucleotides was achieved only in 6 samples and rest 10 samples yielded partial B2L gene sequences upon sequencing. Hence, during this study apart from full length phylogenetic analysis of 6 isolates, analysis of corresponding partial nucleotide sequences of all 16 isolates was carried out to understand the molecular epidemiology of ORFV isolates circulating in Karnataka. This consensus sequence was then further used for alignment with the published sequences of ORFV that are available in GenBank using NCBI Blast and CLUSTAL W (1.82) software and DNAstar software. The details of published sequences of ORFV used for phylogenetic analysis are listed in Table 1. The nucleotide sequences obtained from the B2L gene PCR products of 1137bp (full length) and 250bp (partial length) of all 16 isolates of ORFV were initially aligned with the corresponding ORFV nucleotide sequences published. The full length nucleotide sequences of ORFV KVAFSU VMC-05, ORFV KVAFSU VMC-19, ORFV KVAFSU VMC-20, ORFV KVAFSU VMC-36, ORFV KVAFSU VMC-42, and ORFV KVAFSU VMC-53, isolates shared 100 per cent homology with Assam/09 and Assam/10 isolates (GenBank accession number JN 8468834.1and JQ 040300.1). The partial length nucleotide sequences of ORFV KVAFSU VMC-01, ORFV KVAFSU VMC-17, ORFV KVAFSU VMC-38, ORFV KVAFSU VMC-51, ORFV KVAFSU VMC-55, ORFV KVAFSU VMC-56, ORFV KVAFSU VMC-59, ORFV KVAFSU VMC-60, ORFV KVAFSU VMC-61 and ORFV KVAFSU VMC-63, isolates shared more than 99 per cent homology with Assam/10 isolates (GenBank accession number JQ 040300.1). 3.5 Phylogenetic analysis and sequence pair distance of Orf virus isolates In the present study, all the 16 ORFV isolates were subjected for phylogenetic analysis along with published sequences of ORFV to understand the genetic similarities among the isolates. The nucleotide sequence pair distance of B2L gene for 16 ORFV isolates with published ORFV sequences was determined. The sequence analysis was performed with the MegAlign program of Lasergene 6 package (DNAstar Inc. Madison, USA). Phylogenetic analyses of the 1137 bp fragment of ORFV were conducted using MEGA version 6.06 using the maximum parsimony method with 1000 bootstrap replicates. The tree was constructed with the modules of the MEGA 6.06 Programme.   3.6 Phylogenetic analysis based on full length sequence of B2L gene of Orf virus isolates The nucleotide sequence of full length gene isolates were compared with that of 36 sequences representing Indian and foreign isolates of PPVs including ORFV, Pseudo cow pox virus (PCPV) and Bovine papular stomatitis virus (BPSV), available in the database. The sequence analysis revealed that there was close relationship among the ORFV isolates worldwide. However, ORFVs obtained in this study were clustered separately from other members of the genus. The six isolates of both sheep and goats were grouped in a single cluster, indicating high level of genetic homology between these isolates. The isolates obtained in this study had highest sequence identity with Assam/09 and Assam/10 isolates (Figure 6). Sequence analysis revealed high nucleotide (98.7-100 %) and amino acids (98.4-99.7 %) identity among Indian isolates maximum with Assam/09 & Assam/10 isolates of ORFV               (Figure 8). Sequence analysis with BPSV reference strain showed 84.3-84.5 per cent and 83.1-83.6 per cent sequence identity and with PCPV reference strain showed 94.4-94.7 per cent and               94.7-95.5 per cent sequence identity at the nucleotide and amino acid level respectively. 3.7 Phylogenetic analysis based on partial length sequences (250 bp) of B2L gene of Orf virus isolates The partial sequences (250bp) of ORFV were compared with 16 sequences representing Indian and foreign isolates of PPVs including ORFV, PCPV and BPSV available in the database. The phylogenetic analysis revealed close relationship among the worldwide ORFV isolates. However, ORFVs obtained in this study were clustered separately from other members of the genus. Further, the analysis revealed that 16 isolates of both sheep and goats were grouped in a single cluster, indicating the high level of genetic relatedness between these isolates. The study isolates had highest genetic relationship with Assam/10 Muk/09 and caprine isolates (Figure 7).   Table 1 Details of published sequences of B2L gene (full length) of parapoxviruses used in phylogenetic analysis.  
Sl. No. Gene Origin Collection year Affected Species Accession No. Country of isolation   ORFV-Assam/10 2010 Goat JN846834 India   ORFV-Assam/09 2009 Goat JQ040300 India   ORFV-Shanhjahnpur 82/04 2004 Goat DQ263303 India   ORFV-Mukteswar 59/05 2005 Goat DQ263304 India   ORFV-Muk/00 2000 Goat HM466933 India   ORFV-caprine 2003 Goat AY278208 USA   ORFV-vaccine strain 2003 Goat AY278209 USA   ORFV-SA00 2004 Goat AY386264 USA   ORFV-Nantou 2007 Goat DQ904351 Taiwan   ORFV-Taiping  
REFERENCES

Azwai SM, Carter SD, Woldehiwet Z (1995) Immune responses of the camel (Camelus dromedarius) to contagious ecthyma (Orf) virus infection.Veterinary Microbiology 47: 119-131

Bora DP, Venkatesan G, Bhanuprakash V, Balamurugan V, Prabhu M, Siva sankar MS,  Yogisharadhya R (2011) Taq Man real-time PCR assay based on DNA polymerase gene for rapid detection of orf infection. Journal of Virological Methods 78 : 249-252.

 Bora DP, Barman NN, Das SK, Bhanuprakash V, Yogisharadhya R, Venkatesan G Kumar A, Rajbongshi G, Khatoon E, Chakraborty A, Bujarbaruah KM (2012) Identification and phylogenetic analysis of Orf viruses isolated from outbreaks in goats of Assam, a north - eastern state of India. Virus Genes 45: 98-104.

Caravaglio JV , Khachemoune A (2017) Orf Virus Infection in Humans: A Review with a focus on advances in diagnosis and treatment. Journal of Drugs in Dermatology 16: 684-689.

Chandranaik BM, Harish BR, Mallikarjun patil, Byregowda SM, Mamtha GS, Jayakumar SR, Krishnappa G (2005) Outbreak of Orf in sheep: an investigation. Intas Polivet : 66-67. 

Delhon G, Tulman ER, Afonso CL (2004) Genomes  of  the  Parapoxviruses:  Orf  virus  and  bovine papular stomatitis virus. Journal of Virology 78: 168-177

Fleming SB, Block J, Fraser KM, Mercer AA, Robinson AJ (1993) Conservation of gene structure and arrangement between vaccinia virus and Orf virus. Virology 195: 175-184.

Gelaye E, Achenbach J E , Jenberie S,  Gelagay A, Belay A,  Loitsch MY, Reingard G, Adama D , Charles EL (2016) Molecular charcetrization of orf virus from sheep and goats in Ethiopia,2008-2013. Virology Journal 13:34.

  Hosamani M, Bhanuprakash V, Scagliarini A, Singh RK (2006) Comparative sequence analysis of major envelope protein gene (B2L) of Indian Orf viruses isolated from sheep and goats. Veterinary Microbiology 116: 317-324.

 Hosamani M, Yadav S, Kallesh DJ, Mondal B, Bhanuprakash V, Singh RK, (2007) Isolation and characterization of an Indian Orf virus from goats. Zoonoses and Public Health 54: 204-208.

Hosamani M, Scagliarini A., Bhanuprakash V, Mcinnes CJ, Singh RK (2009) Orf: an update on current research and future perspectives. Expert Review of Anti- infective Therapy 7: 879-893.

Housawi FMT, Abu-Elzein E, Gameel A, Mustafa M,  Nettleton P (2004) Severe Auzsyk infection in one-month-old camel calves (Camelus dromedarius). Veterinary Archives 74: 467-474

Inoshima Y, Morooka A, Sentsui H (2000) Detection and diagnosis of Parapoxvirus    by the PCR. Journal of Virological Methods 84: 201-208.

Inoshima Y, Murakami K, Wu D, Sentsui H (2002) Characterization of parapoxviruses circulating among wild Japanese serows (Capricornis crispus). Microbiology and Immunology 46: 583-587

Kottaridi C, Nomikou K, Teodori l, Savini G, Lelli R, Markoulatos P, Mangana O (2006) Phylogenetic correlation of Greek and Italian Orf virus isolates based on VIR gene. Veterinary Microbiology 16: 310-316.

Kumar  AA, Shivachandra SB, Biswas A, Singh VP, Singh VP, Srivastava SK (2004) Prevalent serotypes of Pasteurella multocida isolated from different animal and avian species in India. Veterinary Research Communication 28 : 657-667.

Mckeever DJ, Reid  HW, Inglis NF, Herring AJ (1987) A qualitative and quantitative assessment of the humoral antibody response of the sheep to Orf virus infection. Veterinary Microbiology 15: 229-241.

Mohamed, Mahmoud A, Khaled Abdelrahman A, Hatem  Soliman (2010) Molecular and virological studies on contagious pustular dermatitis isolates from Egyptian sheep and goats. Research in Veterinary Science 89: 290-294.

 OIE (2007) Manual of diagnostic tests and vaccines for terrestrial animals (mammals, birds and bees). Office International des Epizooties, Paris, France. Pp739-750.

Saitou N, Nei M (1987) The neighbor joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4: 406-425.

Spyrou V, Valiakos G (2015) Orf virus infection in sheep and goats. Veterinary Microbiology 181: 178-182.

 Sullivan JT, Mercer AA, Fleming SB, Robinson AJ (1994) Identification and characterization of an Orf virus homologue of the vaccinia virus gene encoding the major envelope antigen p37K.Virology 202: 968-973

Thompson JD, Higgins DG, Gibson TJ, Clustal W (1994) Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22:4673-4680.

Editorial Board
Indexed & Listed In
Scimago Journal Rank
Track manuscript
Manuscript Statistics
Articles Statistics
Publication Statistics